                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-21.20 kcal/mol

                                                                        Nomenclature/Definitions

AAGGACGGCAATGTCCACGCCATCTGGCACCAGTTCTACAACAACCCGTATCAGTTCG
TGGCCATTCAGGAAATTGCCAAGTGGCTGCACCCGGATCTGTTCAAAGACCTTGACCC
CGAGGCGACCTTCAAGGAATTGCATGCCCGCTTCCTGCCGCTCGACTACAAGTCCGGC
TACTTCGTGTCGCTGAAGGATGCGAAATAAgacagggacggtgaaggggagcgccgtccgatcgatggatgaagccgc
agccctgcggcttcatcgttttgtttaggaactcagtgaggatttctcATG

    AGR_L_2863 --- AGR_L_2865 --- AGR_L_2867 Gene: AGR_L_2863     GI: 15891543     BI number: AGR_L_2863     GOG: COG0614     Description: AGR_L_2863p Gene: AGR_L_2865     GI: 15891544     BI number: AGR_L_2865     GOG: COG0609     Description: AGR_L_2865p Gene: AGR_L_2867     GI: 15891545     BI number: AGR_L_2867     GOG: COG1120     Description: AGR_L_2867           cc          g  c           at           cg           gc           cg           cg           gc           at           at           gc           ta           at           gc             gttttgtttaggaactcagtgaggatttctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here     ..................................................................................................................