                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGATCGTCAAGGACTTGCACGCCTCCGGCAAGATGATCGAATTCGCCAAGGCCAACCG
CCTGCCGAGCATCGGCTACATGGAAGAGCAGAAGAAGAAGCTTTCCGCCGCGCAATAA
ggcgtggggcaatctggttcgtcccctcaccttcgcgtgacggagagcccctgtcacggaggcgttttgcgccaaccctcaagaacggccggtttcgcct
gccgttcttttctgctttataacaaggcaggccattctggcgacgcccgtccggcagcacccgcaataacagcatggatttccgATG

    AGR_L_2929 --- AGR_L_2927 --- AGR_L_2925 --- AGR_L_2924 --- AGR_L_2922 Gene: AGR_L_2929     GI: 15891575     BI number: AGR_L_2929     GOG: COG0765     Description: AGR_L_2929p Gene: AGR_L_2927     GI: 15891574     BI number: AGR_L_2927     GOG: COG0765     Description: AGR_L_2927p Gene: AGR_L_2925     GI: 15891573     BI number: AGR_L_2925     GOG: COG1126     Description: AGR_L_2925p Gene: AGR_L_2924     GI: 15891572     BI number: AGR_L_2924     GOG: COG2079     Description: AGR_L_2924p Gene: AGR_L_2922     GI: 15891571     BI number: AGR_L_2922     GOG: COG2141     Description: AGR_L_2922             c           g  g           t  c           t  c            ta   g        ta a  c       gc g  c      c  | a  c       gc gc        gc gt        at cg        gc at       g  a        t gc       c  a      t  c ta       a  g      t  g gc       c  a       gc cg        ta        gc g  |       gc       c  t cg        tg        cg ta        cg        gc tg       |  c       gc cg       c  c       cg |  c       cg        at cg        cg        at at        gt        gc                         ttttctgctttataacaaggcaggccattctggcgacgcccgtccggcagcacccgcaataacagcatggatttccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here [E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here [E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here [R] COG2079 Uncharacterized protein involved in propionate catabolism ... can be seen here [C] COG2141 Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases ... can be seen here     ..................................................................................................................