                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=2 nt.   Size=14 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTATGCATTGCCCAACTGAtccttttggttcaacactttgaaaaagaaaccccgggagatgattccggggtttttctttgtttg
ggttcaggataaccggcactttcgtgcggaacctcgccatcatcctcgcgttaggaaaacaggcccgccggcaacacaccgccattcaccaagctttcac
aaggcgaatttatgagcttgaacttgtccgcccgtgaaccgatgatggcggtatttggaaatatctatattgtccggcgcgccgggaaattttttagagt
tggaaaggttttgttGTG

    AGR_L_2939 Gene: AGR_L_2939     GI: 15891580     BI number: AGR_L_2939     GOG: COG0662,COG0836     Description: AGR_L_2939            gg           t  a            ta            ta            at            ta            gt            gc           c  t           g  a            gt            ta            at ac       g  t a  c      t  g g  g       at ta        gc gt       |  c cg        cg |  a       cg        gc |  t      a  |      c  g cg       a  |       gc cg        gc        gc gc        tg        cg cg        gc        cg cg        cg        tg                         aaattttttagagttggaaaggttttgttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0662 Mannose-6-phosphate isomerase ... can be seen here [M] COG0836 Mannose-1-phosphate guanylyltransferase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -7.20 kcal/mol Antiterminator: Size=49 nt.     Delta G=-11.50 kcal/mol Anti-antiterminator:   Size=24 nt.     Delta G= -7.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTTATGCATTGCCCAACTGAtccttttggttcaacactttgaaaaagaaaccccgggagatgattccggggtttttctttgtttg ggttcaggataaccggcactttcgtgcggaacctcgccatcatcctcgcgttaggaaaacaggcccgccggcaacacaccgccattcaccaagctttcac aaggcgaatttatgagcttgaacttgtccgcccgtgaaccgatgatggcggtatttggaaatatctatattgtccggcgcgccgggaaattttttagagt tggaaaggttttgttGTG     AGR_L_2939 Gene: AGR_L_2939     GI: 15891580     BI number: AGR_L_2939     GOG: COG0662,COG0836     Description: AGR_L_2939            tg           t  g            ta            aa            ta            gt            ga            ct           g  c           g  t            ta            at            ga ac       t  t a  c      a  t g  g       gg        gc ta        ct       c  g gt       |  c       gc cg        cc        gc |  a       ag        cg |  t      a  |       cg cg       g  |      t  g cg        tg       g  a gc        gc        ta cg        cg        ta cg        cc        at                         tttttagagttggaaaggttttgttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0662 Mannose-6-phosphate isomerase ... can be seen here [M] COG0836 Mannose-1-phosphate guanylyltransferase ... can be seen here     ..................................................................................................................