                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-25.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-15.30 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-24.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATACCCGCTGCTCGCTGGAGCGCTCGCTGCACGGCATCGATGTGATGACCTCGATC
CTGAAGTCAGGTGAAGAAGGCCGTTTCATTGAGATGAACACGACCTGCACGCAGCCGG
CAGCCCTTGGCATCGAGGAGGCGCAGGCGCTGCTGCGCTGAggcttggatgatccggaaagcggcggagg
ggacttcgccgctttcgtgtttttaccgcaacccttcacaatcccttccttttggtttaaagccgcgccgtatccggtcgcagcccacccggtcaaaaca
agggatcccaacttATG

    AGR_L_2950 --- AGR_L_2952 --- AGR_L_2955 Gene: AGR_L_2950     GI: 15891587     BI number: AGR_L_2950     GOG: COG0603     Description: AGR_L_2950p Gene: AGR_L_2952     GI: 15891588     BI number: AGR_L_2952     GOG: COG0720     Description: AGR_L_2952p Gene: AGR_L_2955     GI: 15891589     BI number: AGR_L_2955     GOG: COG0602     Description: AGR_L_2955   A G  G CG TA         g A  G      t  a CG       a  t GC        gc |  G       gc GC        tg TA        tg TG       c  a       gg CG       g  a      g  a C  C      g  a       gc CG       A  g       at GC        Gc        gt AT        Tg        gc CG        Cg        cg GC        Gc        gc GT        Cg        gc CG       G  g       cg |  C       Ta        gc CG        Cg        at GC       G  g       at AT        Tg        at CG        Cg        gc                         gtgtttttaccgcaacccttcacaatcccttccttttggtttaaagccgcgccgtatccggtcgcagcccacccggtcaaaacaagggatcccaacttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0603 Predicted PP-loop superfamily ATPase ... can be seen here [H] COG0720 6-pyruvoyl-tetrahydropterin synthase ... can be seen here [O] COG0602 Organic radical activating enzymes ... can be seen here     ..................................................................................................................