                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-18.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGCCCTGTCGCCGCCGCTGATCGCCGAGAAATCCCATTTCGACGATATCGTATCCA
TTCTGGGCGACGCGCTGAACCGCGCCGTTTAGaataggcaaacctaataaagaaaaggctgcaatagaatttgcag
cctttttttgacatcaatcaaaaaacaagagaaatagactatttattaaagatgataaactatctttccgcagtataaccatccaagcgggaacgtccac
atggcatcgattaacaaaaagatcatatttgtaagtgccgcgatattttctttatcgggaagcgcaGTG

    AGR_L_2981 Gene: AGR_L_2981     GI: 15891604     BI number: AGR_L_2981     GOG: COG0840     Description: AGR_L_2981            aa GA       c  a T  A       gc C  C       gc GC        at CG        ta GC       a  a CG       a  t A  C      G  a GC       A  a       ga CG        Ta       a  a GT        Tg       t  t GT        Ta        at GT       |  a       at TA       |  a       cg CG       G  a       gc Ta        Cg        ta Ta        Cg        cg At        Gc        gc |  a      |  t       gc Cg        Cg        at Cg        Gc        at                         tttttgacatcaatcaaaaaacaagagaaatagactatttattaaagatgataaactatctttccgcagtataaccatccaagcgggaacgtccacatggcatcgattaacaaaaagatcatatttgtaagtgccgcgatattttctttatcgggaagcgcaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................