                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGCCAGAAAGCCGGCTCCTCTGTGCCGCGGGTTCTGCGCCTCAGCCAGGCGCAGGA
TGGCGCAGTCGCCGAAGTTTCATGGACCTGGTTCGACCATACCGTTGCCCGCTACGTT
TCTCGCATACGTTGAgattacgcaaatttcgcgtgatccacgtggacggaggaatttgacgggaggcaagcacgccacggcccgcgctg
cgggttattttgcagttatatttgttagaatcaaagacttattagtttttgatttctgtcagaaataaaattgatacactattgatttcctttttATG

    AGR_L_3073 --- AGR_L_3070 Gene: AGR_L_3073     GI: 15891652     BI number: AGR_L_3073     GOG: COG3839     Description: AGR_L_3073p Gene: AGR_L_3070     GI: 15891651     BI number: AGR_L_3070     GOG: COG1653     Description: AGR_L_3070   t        gg a  t      g  a a  t      c  g a  c      a  g cg        gc gc        ta cg        ta at        tg tg       |  c ta       |  a at       a  c gc       a  g A  |       gc Gc        gc Ta       a  a T  |      g  | Gc        gc Cg        cg         c At       |  g      g  t Tg       a  c       cg A  g       gc        gc C  a       gc        cg Gc        tg        cg Cg        gc        cg Tg        cg        gt                         tattttgcagttatatttgttagaatcaaagacttattagtttttgatttctgtcagaaataaaattgatacactattgatttcctttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3839 ABC-type sugar transport systems, ATPase components ... can be seen here [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................