                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G=-17.80 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGCGCCGCCGCCCATGATGCGGGTGACCACACCATCATCGTCGGCGAAGTGCTGCGC
GCCGCCCATCGCGACGGTGATCCGCTGTGCTTTTCGGGCGGGGCCTTCGGTCGTTTTT
CAAGGCAATAGacagaacgggattttcccgttcgatctcgagagagatttactcttggttgtttaacggagcacgcctgtcgtgctccgttt
ctgttttcgtctgtcagtaaaaaccgcgcttttgctattcatactggaaatcatcttccaaactgtcctagttgatttgacttattaaacagATG

    AGR_L_3085 --- AGR_L_3087 Gene: AGR_L_3085     GI: 15891657     BI number: AGR_L_3085     GOG: COG4625     Description: AGR_L_3085p Gene: AGR_L_3087     GI: 15891658     BI number: AGR_L_3087     GOG: COG5342     Description: AGR_L_3087             t           c  g           c  t ac        gc a  g       cg tg        at ta        cg tg        gc gc        at ta        gc |  c       gc tg        cg gc        at gc        at             tctgttttcgtctgtcagtaaaaaccgcgcttttgctattcatactggaaatcatcttccaaactgtcctagttgatttgacttattaaacagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4625 Uncharacterized protein with a C-terminal OMP (outer membrane protein) domain ... can be seen here [R] COG5342 Invasion protein B, involved in pathogenesis ... can be seen here     ..................................................................................................................