                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGCAGGCCACCGAACTTTACAAGTTCCTGGATCTCGTCGGCTCCGTTCCGGCAACG
ACGGGCAATGTTGCAGAGGACGTGCTGACGACACGCAACGCCATCCGGGCTTTCTGAt
actcggcatcccgacgccccatcaaagccgccccggaaacgaggcggcttttttcattggccgaacctgacgatgaccgggcaaccttgcccgaaagtgc
tcgagcccctgcgtggcaaggcgatgcagccgtggcattgtcgccgccattacaaaagtttaaggtgatttcgcagcgcattggGTG

    AGR_L_3090 --- AGR_L_3088 Gene: AGR_L_3090     GI: 15891660     BI number: AGR_L_3090     GOG: COG0845     Description: AGR_L_3090p Gene: AGR_L_3088     GI: 15891659     BI number: AGR_L_3088     GOG: COG0841     Description: AGR_L_3088   C T  C A  G CG CG GC C  T       cc AT       c  g AT       t  a C  C      a  c GT        cg CG        gc A  A       gc C  t      c  c A  a      t  c G  c      c  | C  |      a  |       aa At        ta       g  a Gc        At        gc Tg        Gc        cg Cg        Ta       c  a Gc       C  |       cg Ta       T  |       cg G  |       Ta        gc C  |       Ta        cg At        Cg        cg Gc        Gc        gc Gc        Gc        at                         tttttcattggccgaacctgacgatgaccgggcaaccttgcccgaaagtgctcgagcccctgcgtggcaaggcgatgcagccgtggcattgtcgccgccattacaaaagtttaaggtgatttcgcagcgcattggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0845 Membrane-fusion protein ... can be seen here [V] COG0841 Cation/multidrug efflux pump ... can be seen here     ..................................................................................................................