Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear
Characteristics of the secondary structures
Terminator: Distance from promoter:115 nt. Distance to gene:21 nt. Distance to run of Ts=0 nt. Size=15 nt. Delta G= -6.00 kcal/mol
Antiterminator: Distance from promoter:79 nt. Size=44 nt. Delta G=-12.60 kcal/mol
Anti-antiterminator: Distance from promoter:59 nt. Size=42 nt. Delta G=-11.60 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTGAAA-GAAAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTGAAACTCATTGTGCTCTTCCCTGAAAATCTGATCCTGTGTGGAAAATCCACCGATA
CCGTGACATCGCATCGAAAGGCGACAGCGCCAAGGCCATCAGCCACgatcctcgtccggttgcctt
ctgccttagcccgtgtggggcctgagcgaaagccggtttttgaactatctgaccaaaaagtGTG

AGR_L_3117
Gene: AGR_L_3117 GI: 15891675 BI number: AGR_L_3117 GOG: NOG09759 Description: AGR_L_3117
c
t c ag
a t t c
gc t c
Cg c c
At cg
| c gt
| c tg
Cg c t
Cg t g
Gt tg
At cg
Cg cg
| c gc
| c t |
| t t |
T t gc aa
A c gt g a
C t cg cg
Cg c a gc
Gc t g a |
Gc gc gc
At cg tg
At ta cg
tttttgaactatctgaccaaaaagtGTG
..................................................................................................................