Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:115 nt.    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -6.00 kcal/mol
Antiterminator:    Distance from promoter:79 nt. Size=44 nt.     Delta G=-12.60 kcal/mol
Anti-antiterminator:    Distance from promoter:59 nt.    Size=42 nt.     Delta G=-11.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-GAAAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAACTCATTGTGCTCTTCCCTGAAAATCTGATCCTGTGTGGAAAATCCACCGATA
CCGTGACATCGCATCGAAAGGCGACAGCGCCAAGGCCATCAGCCACgatcctcgtccggttgcctt
ctgccttagcccgtgtggggcctgagcgaaagccggtttttgaactatctgaccaaaaagtGTG

    AGR_L_3117


Gene: AGR_L_3117     GI: 15891675     BI number: AGR_L_3117     GOG: NOG09759     Description: AGR_L_3117


  c
t  c       ag
a  t      t  c
 gc       t  c
 Cg       c  c
 At        cg
|  c       gt
|  c       tg
 Cg       c  t
 Cg       t  g
 Gt        tg
 At        cg
 Cg        cg
|  c       gc
|  c      t  |
|  t      t  |
T  t       gc        aa
A  c       gt       g  a
C  t       cg        cg
 Cg       c  a       gc
 Gc       t  g      a  |
 Gc        gc        gc
 At        cg        tg
 At        ta        cg
                        tttttgaactatctgaccaaaaagtGTG
    ..................................................................................................................