                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-14.20 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGACGGCGTGGAAGATGCGGCAGGTGCCGTGGTGACGCCGGATACGCTTGACCGTATT
CGCGCCGCCGGTGTCGATCCGCGCCAATCGCTGGTGAGCCATGATAGCTATACCGCTT
TCAAGGCGGCGGGCGATCTTGTCGTGACCGGTCCGACCCTGACGAATGTGAATGATAT
CAGGGCGATTTTGATATGGTGAaggtgtaagcgttcgagccggctctcccgtccggccgtgcgtatcctcaggcagaggccgtt
tttgactatgccgccggagaggtataaattggcggcatatccTTG

    AGR_L_3165 Gene: AGR_L_3165     GI: 15891699     BI number: AGR_L_3165     GOG: -------     Description: AGR_L_3165 ta g  a tg gc g  g at At Gc |  g |  a Tg Gc         c Gc       t  c Tg       c  c A  |      t  g       cc T  |      c  t      t  t A  |       gc       a  c G  |       gc       t  a T  |       cg       g  g T  |       cg        cg T  |       gc        gc T  |      a  |       ta A  |       gc       |  g G  |       cg       g  a Cg       t  t       cg Gc        tg        cg Gt        gc        gc Gc        cg        gc At        gt        cg                         tttttgactatgccgccggagaggtataaattggcggcatatccTTG     ..................................................................................................................