                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-20.90 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-22.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGCGCTTCGGCTTTTTCGCCGACAAGGCCCAGCACCTCATCATGCCCGGCCCGTTC
GAGCGCAACCGTTTTCTGGCGCTGGAGCTGAAAGCTGGCTGGCTCGAAGGTGCCGCCG
GTCTTCTGGTGGCAAACGGCCGCCGGCTCTCGGCCTGAggtgatactcgctgctcacatcgaaccccggccc
aaagccggggtttattgtttttattatacggttcatgcgcccgactttaccccgccgacaattttccagacacctcttgcctgcgataagttgcgggtat
atacccgagacaATG

    AGR_L_3233 Gene: AGR_L_3233     GI: 15891736     BI number: AGR_L_3233     GOG: COG1846     Description: AGR_L_3233   A A  C A  G CG GC         a GC       t  c TG       a  t GC        gc GC        tg TG        gc CG       |  t |  C      |  g |  T       gc |  C       At         a T  T       Gc       c  a T  C       Ta       c  a CG       C  c       cg TG       C  a       gc GC        Gt        gc GC        Gc        cg |  T       Cg        cg |  G       Ta        cg |  A      |  a       cg Cg       |  c       at Cg       |  c       at Gt       |  c       gt Cg       C  c      c  a C  a       Tg       t  t Gt        Cg        at Ta        Gc        cg Gc        Gc        at                         ttttattatacggttcatgcgcccgactttaccccgccgacaattttccagacacctcttgcctgcgataagttgcgggtatatacccgagacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:98 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-14.40 kcal/mol Antiterminator: Size=47 nt.     Delta G=-11.70 kcal/mol Anti-antiterminator:   Size=55 nt.     Delta G=-22.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGAGCGCTTCGGCTTTTTCGCCGACAAGGCCCAGCACCTCATCATGCCCGGCCCGTTC GAGCGCAACCGTTTTCTGGCGCTGGAGCTGAAAGCTGGCTGGCTCGAAGGTGCCGCCG GTCTTCTGGTGGCAAACGGCCGCCGGCTCTCGGCCTGAggtgatactcgctgctcacatcgaaccccggccc aaagccggggtttattgtttttattatacggttcatgcgcccgactttaccccgccgacaattttccagacacctcttgcctgcgataagttgcgggtat atacccgagacaATG     AGR_L_3233 Gene: AGR_L_3233     GI: 15891736     BI number: AGR_L_3233     GOG: COG1846     Description: AGR_L_3233   G T  G G  C GA TA         a CA       t  c TC       a  t TG        gc CG        tg TC        gc GC       |  t |  G      |  g |  C       gc |  C       At G  G       Gc C  G       Ta CC       C  c GT       C  a CC        Gt CT        Gc |  C       Cg |  G       Ta         a |  G      |  a      c  a GC       |  c      c  a TC       |  c       cg GT       |  c       gc GG       C  c       gc A  A       Tg        cg Ag        Cg        cg Gg        Gc        cg Ct        Gc        cg                         tttattgtttttattatacggttcatgcgcccgactttaccccgccgacaattttccagacacctcttgcctgcgataagttgcgggtatatacccgagacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here     ..................................................................................................................