                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:171 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-29.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgttctctttgagtgcgagcgcaagtgcttcaaaacgatttgaactccatttcggtcgcaactggagtggggttcaaatcgagattgatgtcacatctgc
tgacggggctaaccctgatattagttttattggatgtacatcagcgtgaatataaatgtacgtgttatattcaagtagtaaaatttgaatttctaatatt
ttttatttatatttatgtgtttactttatgccggaggtttgtattttgtattttgcagtgactataatattttatctggcgcgtattttagggcaatttt
ATG

    AGR_L_3243 Gene: AGR_L_3243     GI: 15891740     BI number: AGR_L_3243     GOG: COG0500     Description: AGR_L_3243 gc c  a        c ta       t  a gc        gc gt        ta cg        at tg        gc ta       t  t tg       t  g       ta at       a  |      c  a cg        gc        gc cg        at        gc tg       g  |       gc cg        cg        gt at        ta        cg at       a  c      |  a gc       a  g      |  t ta       a  |      |  a ta        cg        at ta        tg        gt at        tg        ta gc        gc        cg cg        gt        gt                         tttattggatgtacatcagcgtgaatataaatgtacgtgttatattcaagtagtaaaatttgaatttctaatattttttatttatatttatgtgtttactttatgccggaggtttgtattttgtattttgcagtgactataatattttatctggcgcgtattttagggcaattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [QR] COG0500 SAM-dependent methyltransferases ... can be seen here     ..................................................................................................................