                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-20.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -7.74 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACCGGCCTGAAGGTGGGTGGCACGCTCTATTCCGATGCGCTTTCCACCGCCGATGGC
CCGGCCGCGACCTATATCGACATGATCAACCACAACATGAAGACGATTACGGCGGCCG
TTCTCAGCCAGTAAaacgcacagtttcggcgtgaattaggggagggtggcgtgcgctgccctctctgcttttgtggtgacccctgccgct
tgccgaggaacgcgctgcggcatcggaacgaaagaatcccttcgcaattgcctgttcctttagcgatttccatttcggtgctacacacctcttcATG

    AGR_L_3264 Gene: AGR_L_3264     GI: 15891752     BI number: AGR_L_3264     GOG: COG0328     Description: AGR_L_3264            aa           g  t           t  t           g  a           c  g   a       g  g       tg c  c      g  g      g  c g  a       cg        cg cg        ta        gc at        tg       g  t at        tg       t  g At       g  g       gc A  c       at        gc T  |       cg        gc G  |      a  |       at A  |       cg        gc Cg        gc        gt Cg        cg        gc Gc        at        gt                         gcttttgtggtgacccctgccgcttgccgaggaacgcgctgcggcatcggaacgaaagaatcccttcgcaattgcctgttcctttagcgatttccatttcggtgctacacacctcttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0328 Ribonuclease HI ... can be seen here     ..................................................................................................................