                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-26.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-11.60 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCCAAGATCTCCTATGACAAGCTCTCGCCGGAAGACCAGAAGCTGCTGCGCCAGGC
GGCCAAGGATTCGGTCGGCAAGATGCGCGAACTCTGGAGTGCCCGCGAAAAAGCGTCG
GAAGAAAAAGTCCGCGCCGGTGGCGCCAACGTCATCAAGGTCAACAAGGAGGAATTCG
CTGCGGCGATGGGTCCGGTCTACGACAAGTTCGTCACCGACCCGAAGATGAAAGACCT
TCTGGAACGGGTGAAAGCGGTCAAGTAAcgcgcggaaaaccggccctggaaacagggccggttttcttTTG

    AGR_L_3346 --- AGR_L_3348 --- AGR_L_3349 Gene: AGR_L_3346     GI: 15891793     BI number: AGR_L_3346     GOG: COG3090     Description: AGR_L_3346p Gene: AGR_L_3348     GI: 15891794     BI number: AGR_L_3348     GOG: COG1593     Description: AGR_L_3348p Gene: AGR_L_3349     GI: 15891795     BI number: AGR_L_3349     GOG: -------     Description: AGR_L_3349   A G  C A  C AT        AG AT       A  T GC       C  A T  T       TA A  G       Gc G  G      |  g A  A       Gc A  A       Cg GC        Gc        aa CG       A  g      g  a CG       A  g       gc CG       A  a       ta AT       G  a       cg |  G      T  a       cg |  A      G  a       cg |  A       Gc        gc |  A       Gc        gc |  G       Cg        cg GC       A  g       cg CG       A  c       at CG        Gc        at AT        Gc        at                         tcttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3090 TRAP-type C4-dicarboxylate transport system, small permease component ... can be seen here [G] COG1593 TRAP-type C4-dicarboxylate transport system, large permease component ... can be seen here     ..................................................................................................................