                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCCGCTTGTTGGTGCCGGCGCGGCGGGCGACGACATCGATTCGAGCGCCGGCCAGA
CCTTTCGCTGCCACTTCGCGGCGGGCCGCTTCAAGGATCGCGGCCCGGGTTCTTTCAG
GGTTCCGTACCTGTGTTGTCGCGCGTTTGCGCTTGGGCGGTAGCGTTTCTTCCGGGGC
CGCATCGAGTGGCTGGTTTTTTGTCGTTTTTTCCATttcagcacccgcttgacaatgttggtgatcggtgttc
ccatgtaaccaattagttataaaacggcaagtgtcgtttacgttcatcatcaaTTG

    AGR_L_3389 --- AGR_L_3390 --- AGR_L_3392 Gene: AGR_L_3389     GI: 15891812     BI number: AGR_L_3389     GOG: COG1653     Description: AGR_L_3389p Gene: AGR_L_3390     GI: 15891813     BI number: AGR_L_3390     GOG: COG1175     Description: AGR_L_3390p Gene: AGR_L_3392     GI: 15891814     BI number: AGR_L_3392     GOG: COG0395     Description: AGR_L_3392 TT T  G        C GC       T  T CG       T  T GC       T  C |  T       GC         C |  T       CG       T  G |  G      G  G      A  A |  G      A  G       CG CG        TG        GT GC        GC        CG CG        GC        CG T  G       CG        GC G  T       GC        GT TA       |  A      G  | TG        GT       G  | GC        GC        CG TG        TG        CG                         TTTTTTGTCGTTTTTTCCATttcagcacccgcttgacaatgttggtgatcggtgttcccatgtaaccaattagttataaaacggcaagtgtcgtttacgttcatcatcaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:103 nt.     Distance to run of Ts=1 nt.   Size=17 nt.     Delta G= -8.10 kcal/mol Antiterminator: Size=32 nt.     Delta G= -9.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CATCCGCTTGTTGGTGCCGGCGCGGCGGGCGACGACATCGATTCGAGCGCCGGCCAGA CCTTTCGCTGCCACTTCGCGGCGGGCCGCTTCAAGGATCGCGGCCCGGGTTCTTTCAG GGTTCCGTACCTGTGTTGTCGCGCGTTTGCGCTTGGGCGGTAGCGTTTCTTCCGGGGC CGCATCGAGTGGCTGGTTTTTTGTCGTTTTTTCCATttcagcacccgcttgacaatgttggtgatcggtgttc ccatgtaaccaattagttataaaacggcaagtgtcgtttacgttcatcatcaaTTG     AGR_L_3389 --- AGR_L_3390 --- AGR_L_3392 Gene: AGR_L_3389     GI: 15891812     BI number: AGR_L_3389     GOG: COG1653     Description: AGR_L_3389p Gene: AGR_L_3390     GI: 15891813     BI number: AGR_L_3390     GOG: COG1175     Description: AGR_L_3390p Gene: AGR_L_3392     GI: 15891814     BI number: AGR_L_3392     GOG: COG0395     Description: AGR_L_3392   G C  C G  T T  T TG TG G  G C  C GG         C CG       T  G GT       A  A CA        CG TG        GT |  C       CG GG        CG TT        GC TT        GT             GGTTTTTTGTCGTTTTTTCCATttcagcacccgcttgacaatgttggtgatcggtgttcccatgtaaccaattagttataaaacggcaagtgtcgtttacgttcatcatcaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:187 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G=-16.40 kcal/mol Antiterminator: Size=46 nt.     Delta G=-16.80 kcal/mol Anti-antiterminator:   Size=39 nt.     Delta G=-23.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CATCCGCTTGTTGGTGCCGGCGCGGCGGGCGACGACATCGATTCGAGCGCCGGCCAGA CCTTTCGCTGCCACTTCGCGGCGGGCCGCTTCAAGGATCGCGGCCCGGGTTCTTTCAG GGTTCCGTACCTGTGTTGTCGCGCGTTTGCGCTTGGGCGGTAGCGTTTCTTCCGGGGC CGCATCGAGTGGCTGGTTTTTTGTCGTTTTTTCCATttcagcacccgcttgacaatgttggtgatcggtgttc ccatgtaaccaattagttataaaacggcaagtgtcgtttacgttcatcatcaaTTG     AGR_L_3389 --- AGR_L_3390 --- AGR_L_3392 Gene: AGR_L_3389     GI: 15891812     BI number: AGR_L_3389     GOG: COG1653     Description: AGR_L_3389p Gene: AGR_L_3390     GI: 15891813     BI number: AGR_L_3390     GOG: COG1175     Description: AGR_L_3390p Gene: AGR_L_3392     GI: 15891814     BI number: AGR_L_3392     GOG: COG0395     Description: AGR_L_3392            CT           A  T           C  C            CG            GC            TG            CG   A        GC G  C       CG C  A      T  | AT       T  | GC       T  | CG       C  | |  A      C  | GT       A  | GT       G  |       AG GC       A  |      A  G CG        CG       C  A G  A       CG       T  T G  |       GC       T  C CG        GC        CG GC       C  |       GC CG        CG        CG GC        GC        CG GC       C  |       GC CG        GT        GC CG        AT        GC GC        GC        CG                         GGTTCTTTCAGGGTTCCGTACCTGTGTTGTCGCGCGTTTGCGCTTGGGCGGTAGCGTTTCTTCCGGGGCCGCATCGAGTGGCTGGTTTTTTGTCGTTTTTTCCATttcagcacccgcttgacaatgttggtgatcggtgttcccatgtaaccaattagttataaaacggcaagtgtcgtttacgttcatcatcaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here     ..................................................................................................................