Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=23 nt.     Delta G=-13.70 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-21.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTGTCTGTTGCCGCTTTCCCATCGCGTAGATCGGCCTTGAGGGCGATCGCCTTCGAG
CCGAGGGCTTCGATCTCGCGGATCGTCGCCTGCGCGGCATCGGGGTTTGCGCCATAAT
GGACGCCGATAAGACCTGCGCCCTCCTTGGCAAATGCCAGGGCGGCGGCACGGCCGAT
GCCCCTTGAACTTCCCGTTATGAGGGCGACTTTGTTCGACAGTTTCTGAGACATggatct
ctccgttgcgatttaactagcgatcgatataataaaagccgaacatgatctgtcaacatttttataGTG

    AGR_L_3469


Gene: AGR_L_3469     GI: 15891851     BI number: AGR_L_3469     GOG: COG1309     Description: AGR_L_3469


 AA
A  T
 CG
 GC
 GC
 TA
 TG                   C
 CG                 T  C
 CG                 T  C
T  C        C        CG
C  |      A  G       AT
 CG        CG        AT
 CG        GC       G  A
 GC        GC       T  T
|  G       CG       T  G
 CG       G  A      C  A
 GC        GT        CG
 TA        CG        CG
|  C       GC        CG
 CG        GC        GC
 CG        GC        TG
                        ACTTTGTTCGACAGTTTCTGAGACATggatctctccgttgcgatttaactagcgatcgatataataaaagccgaacatgatctgtcaacatttttataGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1309 Transcriptional regulator ... can be seen here

    ..................................................................................................................