                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-18.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -6.37 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCTGTCGGAGAAGCTTGTCGAGCGGCTGGAAAAGATGGAACTGGTCGAGGAGAGCT
CCATCCGCGGTGAACCGGTGCTACAGTTGACCACTGTCGGACAGGCGATCAAGGCGCA
GCTGCTTCAATAAtctgtctgcgccggctttgcatccgttggaaagacatccacctcaccacatgaaagcctaaccgggcgacgctactga
ccaatgttttgatataaaaattggtcagtaacgcgggagttgccatcgtgaccaatttttgtatataatttttggacacaatgtaggacaactATG

    AGR_pAT_59 --- AGR_pAT_58 Gene: AGR_pAT_59     GI: 16119272     BI number: AGR_pAT_59     GOG: -------     Description: AGR_pAT_59p Gene: AGR_pAT_58     GI: 16119271     BI number: AGR_pAT_58     GOG: NOG08233     Description: AGR_pAT_58 ac a  c tg cg cg gc a  g       at a  a      g  a a  c      t  t g  g       ta        gg t  c       ta       c  g a  t       ta       g  a c  a      g  a       cg a  c       ta        at c  |       at        at c  |       at        tg at        cg        gc cg        cg       |  c ta        at       |  a c  c       gc       |  t c  c       ta       |  c a  a       cg       |  g c  |       at        at c  |       ta        cg ta       c  a       ta at        gc        gc cg        cg        gc at       a  |       ta gt        gc        ta at        cg        at                         ttttgtatataatttttggacacaatgtaggacaactATG     ..................................................................................................................