                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=61 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctaacgctgttccaatctccgctcattggctactagcagctactcccctggtggccccggaagcccggcaaaacgaaccgtcgtccctcaataaggaatt
ttagtgcgttaggtctggcctaattgcagggccgacggttcgtatccgttcaaggtgaagcatggacactcggttctcgccggtgccagacacgagcgct
gatcgaacctgtcatcaaaacgtcgcaagaccttcaagaaagtgtctcctgcaattgctagacagccgtcattgcaattctttttgcacaggagatacgg
ATG

    AGR_pAT_77 --- AGR_pAT_78 --- AGR_pAT_79 --- AGR_pAT_81 --- AGR_pAT_82 --- AGR_pAT_84 Gene: AGR_pAT_77     GI: 16119286     BI number: AGR_pAT_77     GOG: COG1653     Description: AGR_pAT_77p Gene: AGR_pAT_78     GI: 16119287     BI number: AGR_pAT_78     GOG: COG1175     Description: AGR_pAT_78p Gene: AGR_pAT_79     GI: 16119288     BI number: AGR_pAT_79     GOG: COG0395     Description: AGR_pAT_79p Gene: AGR_pAT_81     GI: 16119289     BI number: AGR_pAT_81     GOG: COG0584     Description: AGR_pAT_81p Gene: AGR_pAT_82     GI: 16119290     BI number: AGR_pAT_82     GOG: COG3839     Description: AGR_pAT_82p Gene: AGR_pAT_84     GI: 16119291     BI number: AGR_pAT_84     GOG: COG1737     Description: AGR_pAT_84 ca g  a cg ta gc c  c a  t a  t a  c a  a c  a t  | a  | c  | t  | g  | t  | c  | c  | a  | a  | g  | cg ta                  gc a  a                a  c g  |       at        cg ta       a  t       at cg        cg        gc gt        gc       |  a cg       t  t      a  t |  t      c  |      t  t gc       c  |       cg at        ta        gc gc        cg        ta c  c       ta        ta at        gc        at cg        ta        at                         ctttttgcacaggagatacggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here [C] COG0584 Glycerophosphoryl diester phosphodiesterase ... can be seen here [G] COG3839 ABC-type sugar transport systems, ATPase components ... can be seen here [K] COG1737 Transcriptional regulators ... can be seen here     ..................................................................................................................