                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -8.25 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCGGTCGGGACTTACAACGATCGCATTTTCGGCATGCCGTTTTCTGCGGATGGTTCG
GTTCTGATCTGGAACAAGAAACTCTTCAAGCAGGCGGGTCTAGACCCGGAAAAGGGAC
CGGCGACCTGGGCTGAGATTCGCGCTGACGCGGAAAGGGTGAATGCGCTCGGGGGTGC
AAGGGCTTTTATTTTTCCGGTAATTGCGGTGGCTGCAACATTTTCACCTTCACGCCGC
TGAtctgggcatcaggtggggatattttttccgcagatggccgacaggtaacgctggatacgccgcagATG

    AGR_pAT_115 --- AGR_pAT_117 --- AGR_pAT_119 --- AGR_pAT_121 --- AGR_pAT_122 --- AGR_pAT_124 Gene: AGR_pAT_115     GI: 16119309     BI number: AGR_pAT_115     GOG: COG1653     Description: AGR_pAT_115p Gene: AGR_pAT_117     GI: 16119310     BI number: AGR_pAT_117     GOG: COG1175     Description: AGR_pAT_117p Gene: AGR_pAT_119     GI: 16119311     BI number: AGR_pAT_119     GOG: COG0395     Description: AGR_pAT_119p Gene: AGR_pAT_121     GI: 16119312     BI number: AGR_pAT_121     GOG: COG3533     Description: AGR_pAT_121p Gene: AGR_pAT_122     GI: 16119313     BI number: AGR_pAT_122     GOG: COG3533     Description: AGR_pAT_122p Gene: AGR_pAT_124     GI: 16119314     BI number: AGR_pAT_124     GOG: COG3839     Description: AGR_pAT_124             A TT       G  t T  C      T  c T  A      C  t A  C      G  g C  C       Cg A  T       Cg A  T       Gc C  C      C  a G  A      A  t T  C      C  c CG       T  | GC        Ta GC        Cg TG        Cg GC        At GT        Cg CG        Tg             ggatattttttccgcagatggccgacaggtaacgctggatacgccgcagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here [S] COG3533 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG3533 Uncharacterized protein conserved in bacteria ... can be seen here [G] COG3839 ABC-type sugar transport systems, ATPase components ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-10.30 kcal/mol Antiterminator: Size=47 nt.     Delta G=-17.20 kcal/mol Anti-antiterminator:   Size=55 nt.     Delta G=-21.19 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTCGGTCGGGACTTACAACGATCGCATTTTCGGCATGCCGTTTTCTGCGGATGGTTCG GTTCTGATCTGGAACAAGAAACTCTTCAAGCAGGCGGGTCTAGACCCGGAAAAGGGAC CGGCGACCTGGGCTGAGATTCGCGCTGACGCGGAAAGGGTGAATGCGCTCGGGGGTGC AAGGGCTTTTATTTTTCCGGTAATTGCGGTGGCTGCAACATTTTCACCTTCACGCCGC TGAtctgggcatcaggtggggatattttttccgcagatggccgacaggtaacgctggatacgccgcagATG     AGR_pAT_115 --- AGR_pAT_117 --- AGR_pAT_119 --- AGR_pAT_121 --- AGR_pAT_122 --- AGR_pAT_124 Gene: AGR_pAT_115     GI: 16119309     BI number: AGR_pAT_115     GOG: COG1653     Description: AGR_pAT_115p Gene: AGR_pAT_117     GI: 16119310     BI number: AGR_pAT_117     GOG: COG1175     Description: AGR_pAT_117p Gene: AGR_pAT_119     GI: 16119311     BI number: AGR_pAT_119     GOG: COG0395     Description: AGR_pAT_119p Gene: AGR_pAT_121     GI: 16119312     BI number: AGR_pAT_121     GOG: COG3533     Description: AGR_pAT_121p Gene: AGR_pAT_122     GI: 16119313     BI number: AGR_pAT_122     GOG: COG3533     Description: AGR_pAT_122p Gene: AGR_pAT_124     GI: 16119314     BI number: AGR_pAT_124     GOG: COG3839     Description: AGR_pAT_124 AC G  C G  G G  G A  C        C A  G      G  G A  A      C  G A  C      A  A GC       G  A GT        TA CG        CG CG       G  G CG        CG        GG A  |       GT       C  G GC        CG        TG AT        TA        CG |  G       TA        GT TA        AT        CG CG       G  G       GC TA       A  C       TA GT       G  |      A  A GT       T  |      A  G GC        CG       G  G CG        GC        TG GC        GT        GC |  G       GC        GT GC        TG        GT AT        CG        AT CG        CG        AT                         ATTTTTCCGGTAATTGCGGTGGCTGCAACATTTTCACCTTCACGCCGCTGAtctgggcatcaggtggggatattttttccgcagatggccgacaggtaacgctggatacgccgcagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here [S] COG3533 Uncharacterized protein conserved in bacteria ... can be seen here [S] COG3533 Uncharacterized protein conserved in bacteria ... can be seen here [G] COG3839 ABC-type sugar transport systems, ATPase components ... can be seen here     ..................................................................................................................