Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-13.20 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cccgtcggacactctgccaaaaggttgactcttgtgccattgccccttgacctcaactctagttgaggttgtacgaattttaaggcggtcgcggcccatc
gaacgcgaccacgtcaaaggagggcgtcttggtcacatattttcgctactcaaaacccaaatattccgtcagaacacgcctggttggagccgtattgttg
cagttacttggcaccggattgttagcgttcatcttttgccatctggacacgcttacggcgaagccaacgataactctcggtcagtttttgccatgcttgg
TTG

    AGR_pAT_211


Gene: AGR_pAT_211     GI: 16119379     BI number: AGR_pAT_211     GOG: -------     Description: AGR_pAT_211


 ct
t  a
 cg
 at
 at
 cg
 ta
 cg
 cg
 at
 gt
|  g
|  t
|  a       at
|  c      c  c        g
|  g      c  g      a  g
|  a      c  a      a  a
|  a      g  a      a  g
|  t       gc        cg
|  t       cg        tg
|  t       gc        gc
|  t       cg        cg
 ta        ta        at
 ta        gc       |  c
 cg        gc       |  t
 cg       |  a      |  t
|  c      |  c       cg
 cg        cg        cg
 cg        gt        at
 gt        gc        gc
                        acatattttcgctactcaaaacccaaatattccgtcagaacacgcctggttggagccgtattgttgcagttacttggcaccggattgttagcgttcatcttttgccatctggacacgcttacggcgaagccaacgataactctcggtcagtttttgccatgcttggTTG


    ..................................................................................................................