Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=1 nt.   Size=16 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.62 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-13.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgggtacgtggaggtcggcccctggaggacgacacagcataatgaaatgaagaagcctgtttaggcacgtcataatccgtcgcgctagacaccaacccgg
aggtcaagcggtaaaacttcagccagctgatccagttgaagggtccagatcaacctccctaagctggagccagcttcctttttcattccccggcatgttt
cggcttgcctagcgttggttcaccttcacgctcgttgcttcggcttatcgagaatctcacgtgttgcatgggttcactttaatgtggccagcttttttga
GTG

    AGR_pAT_390


Gene: AGR_pAT_390     GI: 16119499     BI number: AGR_pAT_390     GOG: COG3668     Description: AGR_pAT_390


  c
a  t
a  t
a  c
a  a
 tg
 gc
 gc
|  a        t
 cg       a  c
 gc       g  a
 at       a  a
a  g      c  c
c  a      c  c
t  |      t  t
g  |       gc
g  |       gc
 at        gc
 gc        at
 gc       a  a
c  a      g  |
c  |       ta
 cg        tg
 at        gc
 at        at
 cg        cg        ag
|  a       cg       g  c
|  a       ta        gc
c  g      a  |       ta
a  g      g  |       cg
 cg       t  |       gc
 at        cg        at
 gc        gc        at
                        cctttttcattccccggcatgtttcggcttgcctagcgttggttcaccttcacgctcgttgcttcggcttatcgagaatctcacgtgttgcatgggttcactttaatgtggccagcttttttgaGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG3668 Plasmid stabilization system protein ... can be seen here

    ..................................................................................................................