                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:180 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-12.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

caattgtaggaactaacgcttggagcggttcaactgttcgaacaccgacgcgggagagttactgattttgcgattgtacgttggcgtacggcagccaagc
gtctcgcgagacatttttccatcgtgaaaggatagaaaaatggccaagcacgctgtgagtggagtttccggaaacacattgaatgatacgcagctagagg
tgttgcgtatcggtatttcagacctggcgccggccctgcggtttttgcccgccgcttcgtcagaaatgaggaggatgtcgatgatctcgttcgagagacg
ATG

    AGR_pAT_407 Gene: AGR_pAT_407     GI: 16119512     BI number: AGR_pAT_407     GOG: COG1595     Description: AGR_pAT_407 tg c  t a  t       ac a  c      t  t cg       t  g ta       g  a ta        at gc        gt g  a       at        cg c  |       gt       a  g g  |      g  g      t  c a  |       gc       g  a gc        cg        cg gc       |  a       gc tg       |  t       gc ta       |  t      |  a |  c      |  g       ta cg       |  t       tg gc       |  a       gc cg        gc        cg |  g       cg        at |  g       at       |  c a  a       gt       |  t a  g       cg       |  c ta        cg        tg cg       a  c       gc at        cg        tg at        at        ta                         gacatttttccatcgtgaaaggatagaaaaatggccaagcacgctgtgagtggagtttccggaaacacattgaatgatacgcagctagaggtgttgcgtatcggtatttcagacctggcgccggccctgcggtttttgcccgccgcttcgtcagaaatgaggaggatgtcgatgatctcgttcgagagacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1595 DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog ... can be seen here     ..................................................................................................................