                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=2 nt.   Size=14 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-14.60 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-18.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCGAAGACCGGGATCAGGTGCGCTGCCTGATAGAGATCATCGATGAACTTCCAGAA
CGCCAGCGCAAAATGCTGGTTGCTTGCCGGCTCGACCAGCGCCGCCATGCCGATATTG
CCGCAGAATTTGGGGTCTCGATCCGCACGGTCGAGCTGGAAGTCCGCAAGGCAGTCGA
CTATTGCAGGGAGCGGCTCGAAACAATAAATCGAGCCTGAagcttcggcttctcatttttcaatcgttga
tagttttagaaacaggtataggcagcatcctgtaacgaacacgtataagggagcggATG

    AGR_pAT_bx251 Gene: AGR_pAT_bx251     GI: 16119537     BI number: AGR_pAT_bx251     GOG: COG3712     Description: AGR_pAT_bx251 CG T  A GC AT C  A G  | G  |        A AT       A  T AT       C  A CG       A  A GC       A  A |  A       AT CG        GC CG        CG TG        TA G  A       CG A  G       GC A  |       GC G  |      |  T GC       |  G TG       |  A       tc CG       |  a      t  g GC        Cg        cg AT        Gc        gc GC        At        at CG        Gt        At TA        Gc        Gc                         tcatttttcaatcgttgatagttttagaaacaggtataggcagcatcctgtaacgaacacgtataagggagcggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [PT] COG3712 Fe2+-dicitrate sensor, membrane component ... can be seen here     ..................................................................................................................