                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:207 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAATCCTCGCGCATTTGGAAGAGACGTTGCAGGTTCGCCCCGTCAGTCTCGTTGGTG
GAATCGTGCTGCTGCGATAGccggaaattttcttcaaaaaaatcgaagaaaaaatttcgggttttcaaattcggatcgttcttcc
tggtagaggccgcgtcaagggatggcgcggcgacgactggcatggggacatcggaatggggcagttcaacgtcggcaagcaaggccgtgagggcaaggca
ataaacaaatggcgaattgcccatctgtctgcgtccatcgcattttcggcgctcgccATG

    AGR_pAT_446 --- AGR_pAT_447 --- AGR_pAT_448 --- AGR_pAT_449 --- AGR_pAT_451 --- AGR_pAT_452 Gene: AGR_pAT_446     GI: 16119538     BI number: AGR_pAT_446     GOG: COG1629     Description: AGR_pAT_446p Gene: AGR_pAT_447     GI: 16119539     BI number: AGR_pAT_447     GOG: COG0614     Description: AGR_pAT_447p Gene: AGR_pAT_448     GI: 16119540     BI number: AGR_pAT_448     GOG: COG2375     Description: AGR_pAT_448p Gene: AGR_pAT_449     GI: 16119541     BI number: AGR_pAT_449     GOG: COG0609     Description: AGR_pAT_449p Gene: AGR_pAT_451     GI: 16119542     BI number: AGR_pAT_451     GOG: COG4779     Description: AGR_pAT_451p Gene: AGR_pAT_452     GI: 16119543     BI number: AGR_pAT_452     GOG: COG1120     Description: AGR_pAT_452             G           A  T           C  C           T  T            GC            CG        TG           |  T      C  C           C  T      G  T AT        CG        TG c  G       CG        GC cG        GT        CG gC       |  G       TA c  A       CG        AT tG        TA       A  A cG        TA       G  | |  T       GT       G  | |  T       GC        TG gC       |  G       Gc cG        AT        Gc gC        CG        Tg gC        GC        Tg                         aaattttcttcaaaaaaatcgaagaaaaaatttcgggttttcaaattcggatcgttcttcctggtagaggccgcgtcaagggatggcgcggcgacgactggcatggggacatcggaatggggcagttcaacgtcggcaagcaaggccgtgagggcaaggcaataaacaaatggcgaattgcccatctgtctgcgtccatcgcattttcggcgctcgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1629 Outer membrane receptor proteins, mostly Fe transport ... can be seen here [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG2375 Siderophore-interacting protein ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [P] COG4779 ABC-type enterobactin transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here     ..................................................................................................................