                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgggtaagtattggtatatgaaggcacgttacgaaccaggattgcggggtatttgggtcaaccggcaaggagaggagggtaacccggactggctgcctta
tgccgagctttcaaaggggccgccagcctgcttcgtccgtaacgccagaggatgggtcgcagattattttgcgcgaccgcgccagaatgcggcggacacg
gtattcggcgagacggggacatccagttcttacaaactcaacttgccggttgcgtttatatcagttatccatagttcaataattcaaggattgtagaaat
ATG

    AGR_pAT_461 --- AGR_pAT_462 --- AGR_pAT_464 Gene: AGR_pAT_461     GI: 16119548     BI number: AGR_pAT_461     GOG: COG0640     Description: AGR_pAT_461p Gene: AGR_pAT_462     GI: 16119549     BI number: AGR_pAT_462     GOG: COG0431     Description: AGR_pAT_462p Gene: AGR_pAT_464     GI: 16119550     BI number: AGR_pAT_464     GOG: COG0477     Description: AGR_pAT_464   c g  c c  a cg gc gc gt g  | a  | a  |        g a  |      c  c c  |      a  c t  |      a  a t  |      t  g t  |      g  a cg        cg gc        cg |  t       ta at        gt gc        cg cg        tg |  t       tg c  c      |  t gc       |  c tg        cg at        gc ta        ta ta        cg             attattttgcgcgaccgcgccagaatgcggcggacacggtattcggcgagacggggacatccagttcttacaaactcaacttgccggttgcgtttatatcagttatccatagttcaataattcaaggattgtagaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0640 Predicted transcriptional regulators ... can be seen here [R] COG0431 Predicted flavoprotein ... can be seen here [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................