                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAATGTTGTTCGCGGCATCAAATGCTCGTCAATGGGCCGGAAAGATCGGCTGCCGTC
GACCCATATCTCCGCAGATCGAAGCCGGTCTCGCAAagcagcgagcgttgcgatcccgtagagtcggcgatca
ggtttttctcgttcgaagatgagccgccggtcagtttggctaaggtgggtgagcgggacgcgatcagggagcgtccgtcgcttctcggcatgaagccgtt
taagcagcgcaattgccgctagaagtggagggggtgcggacgaaaacttggaccaccaggaggtagttcATG

    AGR_pAT_508 Gene: AGR_pAT_508     GI: 16119580     BI number: AGR_pAT_508     GOG: COG2801     Description: AGR_pAT_508   c g  g a  a cg gc a  g At        ga At       a  g Cg       t  t Gc        gc Cg        cg Ta        cg C  t      |  c T  c       cg Gc        ta Gc        at Cg        gc             aggtttttctcgttcgaagatgagccgccggtcagtttggctaaggtgggtgagcgggacgcgatcagggagcgtccgtcgcttctcggcatgaagccgtttaagcagcgcaattgccgctagaagtggagggggtgcggacgaaaacttggaccaccaggaggtagttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2801 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................