                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:   Size=68 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACACATCCCCATTCTCTATCTTCCAGTAACTGACGCGGATGCTGCGAAGGCTTGTCG
GCACCTGCAGATCCGTCGACCATTCGCTGGCGACGCGAAACAGATCGGTCAATCCGTA
GACGGCAGCCAACTGGCAGTTCGGGTAGACCAGTAACCCCACCTCGATGAAATCAGCT
TCTTTGCGTTTTGCCACTTTTGCCTCGGATAAAGTCATTTCCGCCACgtgttcctgtcaggagat
ggcgatattttgtctttgtcaaatacggaatttgcaaacacagcgcgacaggagaaattgaATG

    AGR_pAT_561 Gene: AGR_pAT_561     GI: 16119616     BI number: AGR_pAT_561     GOG: COG0596     Description: AGR_pAT_561   A G  A TA AT GC C  | TA CG C  C A  T C  T C  C C  T C  | AT AT TG        GT GC       A  C A  G      A  A       tt C  T      A  T      g  c C  |      T  T      t  c AT        AT        gt GT        GC        Cg AT        GC        At TG        CG       C  c GC       T  C      C  a GC       C  |      G  | G  A      C  |       Cg C  C       GC        Cg T  T       TA        Ta T  T      T  C       Tg GT       T  |       Ta AT       T  |       At CG        Cg        Cg GC        At        Tg GC        Cg        Gc                         gatattttgtctttgtcaaatacggaatttgcaaacacagcgcgacaggagaaattgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0596 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) ... can be seen here     ..................................................................................................................