Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gctgacgcttccggactggaagcaggtggcagacgttgcgggttggccaaggcgttaggcccgctcgtccggccatcaaccagaatttcgagcggggcgg
ggagacccgacgacagttcagttgtgatgttgcgtcgaacatgcgcctgagtttggaattttggcccgtctcgtcactcatagaatcgagttcccgcgcg
tttgtacggaaacgtactcactgttttcattcgattttccgctgctaatatgattgcaggttgatgttttcgagcagaggggcgaaccagactaaccgct
ATG

    AGR_pAT_717


Gene: AGR_pAT_717     GI: 16119714     BI number: AGR_pAT_717     GOG: COG0664     Description: AGR_pAT_717


  g
a  t
g  t
t  t
 cg        ga
 cg       a  a
g  a      t  t
c  |      a  c
g  |       cg
 ta        ta
 at        cg
c  |       at
 at       |  t
 at       |  c
 gt       |  c
 cg       |  c
 tg       |  g
 gc       c  c
c  c       tg
 gc        gc        aa
 tg        cg       g  a
|  t      |  t       gc
|  c      |  t       cg
t  t      |  t       at
 gc       t  g       ta
 tg       c  t       gc
 at        ta       t  t
 gc        gc       t  c
 ta        cg        ta
 gc        cg        gc
                        tgttttcattcgattttccgctgctaatatgattgcaggttgatgttttcgagcagaggggcgaaccagactaaccgctATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[T] COG0664 cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases ... can be seen here

    ..................................................................................................................