                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAATTCCACCAAGGGCTTCGGCTTCATTCAGCCTGACAACGGCGGCGTTGACGCTTTC
GTTCATATCTCGGCTGTCGAGCGCGCCGGAATGCGCGAACTCGTTGAAGGCCAGAAGA
TTGGCTTCGATCTCGAGCGCGACATGAAGTCGGGCAAGATGTCGGCCTGCAATCTGCA
GTCCGCATAAtcggtatctgcttccctttgaccacggatgtactggcactgccggaagcacgttatcatttaaggccaggcggtttgcctggc
ctttttgtttcgactccaagcctctgaggacctATG

    AGR_pAT_760 --- AGR_pAT_759 Gene: AGR_pAT_760     GI: 16119741     BI number: AGR_pAT_760     GOG: -------     Description: AGR_pAT_760p Gene: AGR_pAT_759     GI: 16119740     BI number: AGR_pAT_759     GOG: -------     Description: AGR_pAT_759   t a  g g  t g  a c  c at cg cg a  | gc         a ta       c  t |  c      t  t |  t       at t  g       ta t  c       ta c  c      g  g cg       c  | cg       a  |        t ta        cg       g  t ta        gc       g  t cg       a  c       cg gc       a  a       gc ta       g  |       gc |  c      g  |       at c  g       cg        cg t  t       cg        cg at        gc        gc ta        tg        gc gt        cg        at gc        at        at                         tttgtttcgactccaagcctctgaggacctATG     ..................................................................................................................