                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-18.61 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGCAATGCCCGTACCCACACCCTGCACGATCCGGTCCGGTGGAAATATTCGATCCT
CGGCAAGTATTTCCTCAATGGCGAGAAGCCACCTCTTCACGCCTGGAGCTGAgaaactttt
ggaacccggggcgcgcaaaggcgcccgcctcgcattcttttagctacctcggccaaaccaatgaaagagattgaacaaatggcgtggaagccgcctcgat
ccaattttcaatcgaaacgctttagggcgaagtgctttgccgggaaccgaagaaaaatagaacagtaatcttgagaggataTTG

    AGR_pAT_771 Gene: AGR_pAT_771     GI: 16119748     BI number: AGR_pAT_771     GOG: -------     Description: AGR_pAT_771 AC C  C C  T GC AT AT GC A  A GC CG GC GC T  T A  | A  |        a C  |      a  c T  |       at CG        gt CG        At TA        Gt        aa T  |       Tg       a  g T  |       Cg        cg A  |      G  a       gc T  |      A  a       cg G  |       Gc        gc A  |       Gc       |  c A  |      |  c      |  c CG       |  g       cg GC        Tg        gc GT        Cg        gc CG        Cg        gt TA        Gc        gc Cg        Cg        cg                         cattcttttagctacctcggccaaaccaatgaaagagattgaacaaatggcgtggaagccgcctcgatccaattttcaatcgaaacgctttagggcgaagtgctttgccgggaaccgaagaaaaatagaacagtaatcttgagaggataTTG     ..................................................................................................................