                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:45 nt.    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.60 kcal/mol
Antiterminator:    Distance from promoter:19 nt. Size=37 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:    Distance from promoter:4 nt.    Size=24 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtca-catcat. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtcagatcacacggaaactgacatcatcctttcgcgggctctaatgggtcgctgataatccacgagcagggtagctctcgaccggaaacgggcgggag
cttttttatttttagGTG

    AGR_pAT_789 --- AGR_pAT_790 Gene: AGR_pAT_789     GI: 16119759     BI number: AGR_pAT_789     GOG: COG0683     Description: AGR_pAT_789p Gene: AGR_pAT_790     GI: 16119760     BI number: AGR_pAT_790     GOG: COG3707     Description: AGR_pAT_790             a           g  g           c  c           a  a            cg            cg            tg        aa aa        at       g  a t  t      |  a       gc cg       a  g       cg tg       t  c       cg cg        at       a  g g  |       gc        gc gt       t  t       cg gc       c  |       tg cg        gc        cg gc        cg        ta |  t       ta        cg cg        gc        gc ta        gc        at                         tttttatttttagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0683 ABC-type branched-chain amino acid transport systems, periplasmic component ... can be seen here [T] COG3707 Response regulator with putative antiterminator output domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:46 nt.    Distance to gene:10 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-19.00 kcal/mol Antiterminator:    Distance from promoter:11 nt. Size=37 nt.     Delta G= -9.30 kcal/mol Anti-antiterminator:    Distance from promoter:4 nt.    Size=24 nt.     Delta G= -6.50 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtca-catcat. It has a score value of 62.92 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtcagatcacacggaaactgacatcatcctttcgcgggctctaatgggtcgctgataatccacgagcagggtagctctcgaccggaaacgggcgggag cttttttatttttagGTG     AGR_pAT_789 --- AGR_pAT_790 Gene: AGR_pAT_789     GI: 16119759     BI number: AGR_pAT_789     GOG: COG0683     Description: AGR_pAT_789p Gene: AGR_pAT_790     GI: 16119760     BI number: AGR_pAT_790     GOG: COG3707     Description: AGR_pAT_790             a           t  a           a  t           g  c            tc            ca            gc aa        cg        aa t  t      |  a      g  a cg       t  g       gc tg       g  c       cg cg        ga        cg g  |       gg       a  g gt       t  g       gc gc       a  |       cg cg        ag        tg gc        tt        cg |  t       ca        ta cg        tg        cg ta        cc        gc                         ttttttatttttagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0683 ABC-type branched-chain amino acid transport systems, periplasmic component ... can be seen here [T] COG3707 Response regulator with putative antiterminator output domain ... can be seen here     ..................................................................................................................