                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-22.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGATGGCCAATCGAGGTACCAGCGAGAATGAAGCCTATCGTGAAATGCGCGAACAGGC
GATGGCCCGGCGCGTGCCGATCGATGAGATCGCCAATTCGATTATCAGTGCTGAACAG
CTCTTGCGCCCTCCCCAAAAACATGATTAGtttttcatgtgttccaaatgaacacctccgacacatcccttcgttttg
cgaagccatgtgtcgctgttgcacgcggcaaaagccgtgatgcggtgatggcaagggtgcccgcaggctgtgacaagcctcgcgggttttttgttatctg
ctgacaGTG

    AGR_pAT_792 --- AGR_pAT_793 --- AGR_pAT_795 --- AGR_pAT_797 --- AGR_pAT_798 --- AGR_pAT_799 Gene: AGR_pAT_792     GI: 16119761     BI number: AGR_pAT_792     GOG: COG0683     Description: AGR_pAT_792p Gene: AGR_pAT_793     GI: 16119762     BI number: AGR_pAT_793     GOG: COG0559     Description: AGR_pAT_793p Gene: AGR_pAT_795     GI: 16119763     BI number: AGR_pAT_795     GOG: COG4177     Description: AGR_pAT_795p Gene: AGR_pAT_797     GI: 16119764     BI number: AGR_pAT_797     GOG: COG4674     Description: AGR_pAT_797p Gene: AGR_pAT_798     GI: 16119765     BI number: AGR_pAT_798     GOG: COG0410     Description: AGR_pAT_798p Gene: AGR_pAT_799     GI: 16119766     BI number: AGR_pAT_799     GOG: COG0388     Description: AGR_pAT_799 aa a  a cg gc gc cg gt cg a  a c  t g  | t  |       gg tg       a  g       ga gc        at       t  c tg        cg       g  a cg        gc        ta gt        gc        cg cg       |  c       gc ta       |  g       gc g  |      t  c       at t  |      a  a      |  c g  |      g  g       cg t  |       tg        gc at        gc        cg cg        gt        cg cg        cg        cg gc        gt        gt                         tttttgttatctgctgacaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0683 ABC-type branched-chain amino acid transport systems, periplasmic component ... can be seen here [E] COG0559 Branched-chain amino acid ABC-type transport system, permease components ... can be seen here [E] COG4177 ABC-type branched-chain amino acid transport system, permease component ... can be seen here [R] COG4674 Uncharacterized ABC-type transport system, ATPase component ... can be seen here [E] COG0410 ABC-type branched-chain amino acid transport systems, ATPase component ... can be seen here [R] COG0388 Predicted amidohydrolase ... can be seen here     ..................................................................................................................