Gene putatively regulated by attenuation in A_tumefaciens_C58_Cereon_pl-Ti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:198 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGGCGTTCTGCCGAGCGACGAACTCGACGACGAAGACGATCTGGAGATCGTGCATG
AATACGTTCCGGGCGGGTCTCATtgagacccttctcgcctttttggtgccgcttgcgagccgcaggcggcaagggaagcttcg
ccgctgctggcacccgggcggtggcccaaggtgcagattgtcatcttgccagccgcgcccttgcctcctttgctcttcgcgatgtccggagcgggcccgc
aaggtgcggggaaaagaaacagaaggaaaggcggacgcaagggtgcgtcgggaattcaaATG

    AGR_pTi_180


Gene: AGR_pTi_180     GI: 41223333     BI number: AGR_pTi_180     GOG: -------     Description: hypothetical protei


           TG
          A  A
          C  A
           GT
           TA
           GC
           CG
          T  |
          A  |        T
           GT       A  t
           AT        Cg
 GG        GC        Ta
T  A       GC        Cg
 CG        TG        Ta
 TA        CG        Gc
 AT        TG        Gc
 GC       |  C       Gc
 CG       A  G      |  t
 AT       G  G      C  t
G  G       CG        Gc
A  |       AT        Gt
 GC        GC        Gc
 TA        AT        Cg
                        cctttttggtgccgcttgcgagccgcaggcggcaagggaagcttcgccgctgctggcacccgggcggtggcccaaggtgcagattgtcatcttgccagccgcgcccttgcctcctttgctcttcgcgatgtccggagcgggcccgcaaggtgcggggaaaagaaacagaaggaaaggcggacgcaagggtgcgtcgggaattcaaATG


    ..................................................................................................................