                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=61 nt.     Delta G=-27.80 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G=-15.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTCGATGGTGCGATCCTTGATCCACGTTCCACCTGGGCCGATGGCGCAGCTTACGA
CGCGCAGGCGAAGAAGCTGGTATCGATGTTCGTTTCGAACTTCACCAAGTTCGAAGAT
CACGTCGACAGCAAGGTTCGCGACGCAGCCCCGGGCCTTCTGCTCGCGGCTGAATGAa
tataaagtctttcgtgaggaggagggaacccggcccagtgccgggtttctttttgccgggttctttcattttgtccgctgttttcattttttgcgttctg
tggcatcaccggcgcggagaaagatcATG

    Atu0036 Gene: Atu0036     GI: 17933961     BI number: Atu0036     GOG: COG1186     Description: conserved hypothetical protei            ta           a  t           A  a           G  a           T  a           A  g            At            Gc           T  t           C  t            Gt            Gc            Cg            Gt            Cg            Ta            Cg           G  g   T        Ta T  C       Cg C  T       Tg CG        Ta GC        Cg GT        Cg         a GC       |  g      c  g CG       |  a      c  t C  C      |  a       cg CG        Gc        gc CG        Gc        gc GC        Gc        cg AT        Cg        cg CG        Cg        cg                         tttctttttgccgggttctttcattttgtccgctgttttcattttttgcgttctgtggcatcaccggcgcggagaaagatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1186 Protein chain release factor B ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-16.80 kcal/mol Antiterminator: Size=61 nt.     Delta G=-27.80 kcal/mol Anti-antiterminator:   Size=44 nt.     Delta G=-17.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCGTCGATGGTGCGATCCTTGATCCACGTTCCACCTGGGCCGATGGCGCAGCTTACGA CGCGCAGGCGAAGAAGCTGGTATCGATGTTCGTTTCGAACTTCACCAAGTTCGAAGAT CACGTCGACAGCAAGGTTCGCGACGCAGCCCCGGGCCTTCTGCTCGCGGCTGAATGAa tataaagtctttcgtgaggaggagggaacccggcccagtgccgggtttctttttgccgggttctttcattttgtccgctgttttcattttttgcgttctg tggcatcaccggcgcggagaaagatcATG     Atu0036 Gene: Atu0036     GI: 17933961     BI number: Atu0036     GOG: COG1186     Description: conserved hypothetical protei            ag           g  g           t  a           g  g           c  g           t  a            tg            tg   T       c  g T  C      t  a C  T       ga CG        ac GC        ac GT        ac GC        tg CG        ag C  C       tc CG       a  c CG        Ac GC        Ga         a AT        Tg       c  g CG        A       c  t G  A       A        cg C  A       G        gc A  |      |         gc G  |      |         cg C  |      |         cg GT        T        cg CG        C        at TA        G        at Ta        G        gt Gt        C        gc                         tttttgccgggttctttcattttgtccgctgttttcattttttgcgttctgtggcatcaccggcgcggagaaagatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1186 Protein chain release factor B ... can be seen here     ..................................................................................................................