                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:119 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-11.91 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGGCTTGTCGGTCAGATCGATGGTTGCGTCGATGCCAGCCTCGCGGGCGGCACGCTC
GAAAGCTTTGGTGGCCGAACGCAAATTGCCCGAACCGTAGTCGATAATCGCGACACGC
ATgtcagcgccttccattcaagtcgaaaagaaacgatccggcgggatcgtcgacgaagtttttgccaccgctcttttgcgcagaagtggtccagaccgg
ccgggacaactgttccgccttgtcggcgttttcggagaggctggagaaatatatatcttccgcgcttgaaagatcaggggcggaaATG

    Atu0042 Gene: Atu0042     GI: 17933967     BI number: Atu0042     GOG: -------     Description: Hypothetical Protei GC C  A AT Cg At Gc |  a Cg Gc         a        gc Cg       a  a      g  g T  c      g  a       cg A  c       cg        cg A  t       ta        ta T  |      g  a       at At       a  a       gc Gc       a  c       cg C  c       cg       a  | Ta        ta       a  | Gt       t  t      a  | At       a  c      g  | T  c      c  c      a  | G  a      c  |      a  | C  a      t  |      a  | C  g      t  |       at A  |       cg        gc At        cg        cg Gc        gc        ta Cg        cg        gc                         gaagtttttgccaccgctcttttgcgcagaagtggtccagaccggccgggacaactgttccgccttgtcggcgttttcggagaggctggagaaatatatatcttccgcgcttgaaagatcaggggcggaaATG     ..................................................................................................................