                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-20.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -8.01 kcal/mol
Anti-antiterminator:   Size=77 nt.     Delta G=-21.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCACCGGATCGTGGTGGGTCTGCCGTCAAGATCGATCAGGAATACGTCAAAAAACAT
GTCGGCGATCTTGCCGCCGATACGGATTTGTCGCGTTACATTCTCTGAagacttcagggacaac
gaaagaagagtgcggccatatttgccgcactcttttattttatctgcctcatctcgcattcagcccgcattttgtttatgggaagggctgcattccggtt
ggaaccgctttcgtggaatgatccggttttcccgcttgtcatgccgggaagggccggctcgagaaaaggcagtcgctcGTG

    Atu0046 --- glcB Gene: Atu0046     GI: 17933971     BI number: Atu0046     GOG: NOG05105     Description: conserved hypothetical protein Gene: glcB     GI: 17933972     BI number: Atu0047     GOG: COG2225     Description: malate synthase   T C  T T  G A  C GC CG GC GC CG TA GT TA A  C C  G        a A  G      g  c A  A       at A  |       At AT        Gc AT        Ta AT        Cg CG        Tg |  T       Cg |  C       Ta TG       |  c GC       |  a CG       |  a AT       |  c        a |  T      |  g      t  t |  A      |  a      a  t |  C      |  a      c  t TA       |  a       cg AT       |  g       gc AT       |  a       gc GC       |  a       cg |  T      |  g       gc GC       |  a       ta AT        Tg        gc CG        At        at TA        Cg        gc A  a      A  c       at G  |      T  g       at Cg        Tg        gt Ta        Gc        at                         attttatctgcctcatctcgcattcagcccgcattttgtttatgggaagggctgcattccggttggaaccgctttcgtggaatgatccggttttcccgcttgtcatgccgggaagggccggctcgagaaaaggcagtcgctcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2225 Malate synthase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:144 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-11.70 kcal/mol Antiterminator: Size=46 nt.     Delta G= -8.01 kcal/mol Anti-antiterminator:   Size=77 nt.     Delta G=-21.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGCACCGGATCGTGGTGGGTCTGCCGTCAAGATCGATCAGGAATACGTCAAAAAACAT GTCGGCGATCTTGCCGCCGATACGGATTTGTCGCGTTACATTCTCTGAagacttcagggacaac gaaagaagagtgcggccatatttgccgcactcttttattttatctgcctcatctcgcattcagcccgcattttgtttatgggaagggctgcattccggtt ggaaccgctttcgtggaatgatccggttttcccgcttgtcatgccgggaagggccggctcgagaaaaggcagtcgctcGTG     Atu0046 --- glcB Gene: Atu0046     GI: 17933971     BI number: Atu0046     GOG: NOG05105     Description: conserved hypothetical protein Gene: glcB     GI: 17933972     BI number: Atu0047     GOG: COG2225     Description: malate synthase   G T  T T  C T  G AC GG GT CT AA TC AA GT C  T C  C        a G  T      g  c C  C       at C  |       At GT        Gc TG        Ta TA        Cg Ca        Tg |  g       Cg |  a       Ta Tc       |  c At       |  a G       |  a C       |  c |        |  g |        |  a |        |  a G       |  a G       |  g C       |  a        a T       |  a      t  t |        |  g      a  t G       |  a      c  t T        Tg        cg A        At        gc C        Cg        gc A        A  c       cg A  |      T  g       gc A        Tg        ta A        Gc        gc                         tcttttattttatctgcctcatctcgcattcagcccgcattttgtttatgggaagggctgcattccggttggaaccgctttcgtggaatgatccggttttcccgcttgtcatgccgggaagggccggctcgagaaaaggcagtcgctcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2225 Malate synthase ... can be seen here     ..................................................................................................................