Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGCTTTCCGGGAGTTTCGATCTCACCATTTTTGTGGGTCCATCCGTCGCGGTGCTTG
AAGAGAGGCTGCGCAACAGATGGCAGGGCTATGGGCTCAATGCCGCTCAAATCCACGC
CAAACTGTTTGAAAACGATCTTCCCAACGGAAAAAGGGTGATCGAAAACGCCCGTCCC
GCCGATATCCACATCGATATCTGGGAATAGattaacacttttcccccttgagtggcagttccgatctgccgttaagcc
tttgttgaccatgtgttgaatctttttgatccacagggtggggcttttGTG

    Atu0067


Gene: Atu0067     GI: 17933986     BI number: Atu0067     GOG: -------     Description: hypothetical protei


            a
          t  a
          t  c
          a  a
           Gc
           At
          T  t
           At
 CA        At         c
A  T       Gc       c  g
C  C       Gc       t  a
 CG        Gc       t  t
 TA       |  c       gc
 AT       |  c       at
 TA       |  t       cg
 AT       T  t       gc
 GC        Cg        gc
C  |       Ta        tg
C  |      A  g      g  |
 GT       T  |       at
 CG       A  |       gt
 CG        Gt        ta
 CG        Cg        ta
 TA        Tg        cg
                        cctttgttgaccatgtgttgaatctttttgatccacagggtggggcttttGTG
    ..................................................................................................................