Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:191 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccgaaatagaggacatgaggtcttctggctcaaccgttatctccgccacggatgtactggcggcatttaacggacataaaaggcgggggtgaccccgctt
tttcttttttggggacgttccagcctgcggtatcgtgcggatggtgagcggcggttctgcccatggctctcaaagttacttccctccgacacgcctcatt
tgatgaaaacaaagagtgaaagcgtattcgcgattccattcccgcggaaaaggctctaaagcggagtatctcccgcaaaagccgcgaaagctttccctcc
ATG

    Atu0080


Gene: Atu0080     GI: 17933999     BI number: Atu0080     GOG: COG0679     Description: permeas


            a
          c  t
          g  t
          g  t
          c  a
          g  a
           gc
           tg
           cg
          a  |
           ta        tg
           gc       g  a
  t        ta        gc
a  g       at        gc
g  t      g  a       gc
g  a      g  a       gc
c  c      c  a       cg
 at       a  a       gc
 cg        cg        gt
 cg        cg        at
 gc        gc        at
 cg        cg        at
 cg        cg        at
                        cttttttggggacgttccagcctgcggtatcgtgcggatggtgagcggcggttctgcccatggctctcaaagttacttccctccgacacgcctcatttgatgaaaacaaagagtgaaagcgtattcgcgattccattcccgcggaaaaggctctaaagcggagtatctcccgcaaaagccgcgaaagctttccctccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0679 Predicted permeases ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:198 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccgaaatagaggacatgaggtcttctggctcaaccgttatctccgccacggatgtactggcggcatttaacggacataaaaggcgggggtgaccccgctt
tttcttttttggggacgttccagcctgcggtatcgtgcggatggtgagcggcggttctgcccatggctctcaaagttacttccctccgacacgcctcatt
tgatgaaaacaaagagtgaaagcgtattcgcgattccattcccgcggaaaaggctctaaagcggagtatctcccgcaaaagccgcgaaagctttccctcc
ATG

    Atu0080


Gene: Atu0080     GI: 17933999     BI number: Atu0080     GOG: COG0679     Description: permeas


            a
          c  t
          g  t
          g  t
          c  a
          g  a
           gc
           tg
           cg
          a  |
           ta
           gc
  c        ta
a  a       at
g  t      g  a
g  g      g  a       tg
a  a      c  a      g  a
 gg       a  a       gc
 ag        cg        gc
 tt        cg        gc
 ac        gc        gc
 at        cg        cg
 at        cg        gc
                        tttttcttttttggggacgttccagcctgcggtatcgtgcggatggtgagcggcggttctgcccatggctctcaaagttacttccctccgacacgcctcatttgatgaaaacaaagagtgaaagcgtattcgcgattccattcccgcggaaaaggctctaaagcggagtatctcccgcaaaagccgcgaaagctttccctccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0679 Predicted permeases ... can be seen here

    ..................................................................................................................