                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -7.50 kcal/mol
Antiterminator: Size=12 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGTGTTCATCGCGCCCGCCCGCTCCAGTGCCCAGAGATCCGACACGTCTTCCACCA
CGATGATGACGGACTGGTCACGCCGGTCATCGGCGCAGACAGTGCAGGGATCGATCGT
ATCGACATTGCCGCAGCAGGAGCAGATCTTCACCTTGTCATAGGCTTCGCCCATGGCA
TGGCCGAGCGGCCCGAGAAGCTGTTCTTTCTTCTTGATGAGATGCAATGCCGCCCGCC
GCGCCGAGCGGGGGCCAAGCCCCGGCACTTTTGCCAGAAGCTGGATCAGTTTTTCAAT
TTCGGGACCGGTG

    Atu0094 Gene: Atu0094     GI: 17934013     BI number: Atu0094     GOG: COG2258     Description: conserved hypothetical protei   T T  C CG GC GC A  C TA AT CG TG                   A GC                 G  G TA                 C  A T  T                C  A CG                  CG CG        AG        GC A  C      G  C       GT C  C       CG        CG TG        CG        GT TA        GC        AT CG        GC        GC                         TTTCTTCTTGATGAGATGCAATGCCGCCCGCCGCGCCGAGCGGGGGCCAAGCCCCGGCACTTTTGCCAGAAGCTGGATCAGTTTTTCAATTTCGGGACCGGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2258 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................