                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-23.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.77 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCAGGCGGGCGGTGCGCTCGCCTCCCGTTTCAGCCGTGAATACCGCTACACCGGC
GCGTCGCTCACCTCGGATATTTCCTGGCTGATCGGTGCCGGTTTCGCACCGCTCGTGG
CACTCGGATTTTCGTCCAAATTCGGATTGTTCGCGGTCGGAATTTACCTGATGTCGGG
AGCTGTCTGTACGCTGGTTGCCCTTTGGTTCAGCCGGACGCTGGAAATGCCTTCGGAG
TGAtcccggcaatttaacaatccctgcagccttcgcgccgcggaatcctgtcggatttcgcggcgtttTTG

    Atu0144 Gene: Atu0144     GI: 17934062     BI number: Atu0144     GOG: -------     Description: hypothetical protei            cc           c  t           t  g           a  c           a  a           c  g           a  c       gt           a  c      t  c           t  t       cg TG       t  t       cg G  A      t  c       ta At       a  g       at Gc       a  c       at Gc        cg        gt C  c       gc        gc T  |       gc        cg T  |       cg        gc Cg       |  c       cg Cg        cg        cg Gc        cg        gc Ta        ta        cg                         tttTTG     ..................................................................................................................