Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGACATCGACGACATCGGCGGCTCCGCACTTTACCTGCTGTCCAGCCTGTCGCGCGG
CGTGACCGGCGAATGTCATTACGTGGATTGCGGTTACAATATCACCTCGACGCCCACG
CTTGAGGTTCTGTCCAAGGCAGACGCGGAATAAgtcgtcttctgatattcgacaaaagcccggccatgtgccgggc
ttttttatgcgccgtatcaattttggaaatcactaaagtatagtttatcgaagtaactgaatttaaacatggggtggttatggtccgcaacaaattcaac
ggttgcgcTTG

    Atu0148 --- Atu0147


Gene: Atu0148     GI: 17934066     BI number: Atu0148     GOG: COG4961     Description: conserved hypothetical protein
Gene: Atu0147     GI: 17934065     BI number: Atu0147     GOG: COG4961     Description: conserved hypothetical protei


 tg
c  a
t  t
t  a
c  t
t  t
 gc
 cg
 ta
 gc
A  a
A  a
T  a
A  a
A  g        t
 Gc       a  g
 Gc       c  t
C  |       cg
 Gc        gc
 Cg        gc
|  g       cg
|  c       cg
A  c       cg
G  a       gc
 At        at
 Cg        at
            ttttatgcgccgtatcaattttggaaatcactaaagtatagtttatcgaagtaactgaatttaaacatggggtggttatggtccgcaacaaattcaacggttgcgcTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[U] COG4961 Flp pilus assembly protein TadG ... can be seen here
[U] COG4961 Flp pilus assembly protein TadG ... can be seen here

    ..................................................................................................................