                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:208 nt.    Distance to gene:15 nt.     Distance to run of Ts=3 nt.   Size=13 nt.     Delta G= -6.70 kcal/mol
Antiterminator:    Distance from promoter:191 nt. Size=24 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:    Distance from promoter:147 nt.    Size=56 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCG-GAAATT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCGAAGGCGCCGCCGGTTTCGGAAATTTCGGTGATCCGGTGAACCATGAGCATGG
GGGGCAATGGGAGCTGGGCATTTCCCGGGCCGAACAATTCGCCGCGACCGCAGGACAG
GATCTCCTCGTAGTTGTAACTTGATTGCCTGGTTGCCATaccgctttcacttccccaatcactggtgttga
acgacttcactagagcaagttaggttcaaaatgaagcgctgcaagggcagaggccgctccggccccattctttgtcttcagaaccttctTTG

    Atu0152 --- irr Gene: Atu0152     GI: 17934070     BI number: Atu0152     GOG: -------     Description: hypothetical protein Gene: irr     GI: 17934071     BI number: Atu0153     GOG: COG0735     Description: transcriptional regulator, Fur famil   t g  t a  a a  g cg gt at gc |  a a  a t  a c  a at cg ta ta cg a  |       ag gc       a  g cg        cg a  c       gc a  t       ta g  |       cg t  |      |  a tg       |  g        t gc       |  g      c  c ta       |  c       gc g  a       gc        cg g  |       cg        cg tg        gc        gc cg        at        gc                         ccattctttgtcttcagaaccttctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0735 Fe2+/Zn2+ uptake regulation proteins ... can be seen here     ..................................................................................................................