                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-13.30 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCCGGACATGCCGATGGTCACGGCCGTTTCGGCATAGGCGGAAGCAGACGAAACAAG
CGTCGCGATTGCGGCGATAACCCATGTTCTTTTCATgatcggaacccctttttgatttatttttgtgcgatat
ttttttcgctttatttgaggcatgctaggcagggattttacatttgtctagacaaaatagaggtactgaaacgcttccagaaagattgcaaacggaccgc
ccggcattctagacataggataacacagccaggcgcatcggcccgctgttttctatatcgagtctttccATG

    Atu0156 Gene: Atu0156     GI: 17934074     BI number: Atu0156     GOG: COG3619     Description: conserved hypothetical protei            ac           g  a            at            ta            cg            tg   c        ta c  g       at a  c      |  a gc       |  a gc       |  c       at cg       |  a      c  c a  |      |  c      g  g a  |      |  a       cg a  |       cg        gc cg        gc        gc gc        gc       a  c ta       c  a      c  | t  t       cg        cg at        cg        gc gc        gc        at at        cg        cg                         ttttctatatcgagtctttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3619 Predicted membrane protein ... can be seen here     ..................................................................................................................