                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=0 nt.   Size=14 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -9.61 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGGATATGACGGAAACATTCCAGAGCTTTGAAACTGCATTCTGCGCAAGACCCGTG
ATTGTGATCTCGGCAATTGGCGTGGCAGTTCCTCCAAAGCCCCGGAATAACGTCCCCA
TCGGGATCGGCTGCTGCGAAAGCGGCTTTTTACTGCATAATTCCTGAtgcgagatgaaacctctc
ggcgaaattcacgtttctgttcgcgtgtaggcagagcggttaacgcgccagtgtcggaggcgagatcaacagatggtcgcgcacccgggacaggtccatc
tcttttgaggctgaaagaaATG

    Atu0165 Gene: Atu0165     GI: 17934083     BI number: Atu0165     GOG: -------     Description: transcriptional regulato            AT           C  C            CG            CG            CG            TA            GT GC       C  | A  C      A  | A  C      A  | A  C      T  | CG       A  | CG       A  | TA       G  | C  A       GC C  T       CG TA        CG TA       |  C GC       C  T |  G       CG |  T       GC        AA A  C       AT       G  A C  C      A  G       CG GC       A  C       GC GC       C  |       TG TA        CG        CG GT        TA        GC                         TTTTTACTGCATAATTCCTGAtgcgagatgaaacctctcggcgaaattcacgtttctgttcgcgtgtaggcagagcggttaacgcgccagtgtcggaggcgagatcaacagatggtcgcgcacccgggacaggtccatctcttttgaggctgaaagaaATG     ..................................................................................................................