                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-14.60 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTAAAACACAGCACTAGgcccaagcgggcgggataacgaaagtcgcgatgacgttcgttatcccgcaccgcgcacgctcacgcagtcc
tggtttgcgctggccatatctcctcaccatctccctctacgacttcagcgcgttcggaagatttgccgcgttttgaatgcgcttttttccatctgcatca
tcattctgtcacggaaagcgattacctcgcactcctgaccttgcgggaagcgggcgagtcacgccaaatagcttctcatccctggttttcatgacaccga
agagtgcttgccGTG

    Atu0170 --- phnM --- gmk Gene: Atu0170     GI: 17934088     BI number: Atu0170     GOG: NOG06388     Description: conserved hypothetical protein Gene: phnM     GI: 17934087     BI number: Atu0169     GOG: COG3454     Description: conserved hypothetical protein Gene: gmk     GI: 17934086     BI number: Atu0168     GOG: COG3709     Description: guanylate kinas             g   c       t  c t  a      t  c t  g      t  g c  c      a  c a  g      g  g gc        at cg        at at        gt t  t       gt c  c       cg t  |       ta cg        ta cg        gt c  a       cg ta        gc cg        cg ta        gc at        at             tttttccatctgcatcatcattctgtcacggaaagcgattacctcgcactcctgaccttgcgggaagcgggcgagtcacgccaaatagcttctcatccctggttttcatgacaccgaagagtgcttgccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3454 Metal-dependent hydrolase involved in phosphonate metabolism ... can be seen here [P] COG3709 Uncharacterized component of phosphonate metabolism ... can be seen here     ..................................................................................................................