                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.53 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-13.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTCTCGAAACCATGGCGGCCATGGCGGTGATGATGCATGCCGATACCGCCTATGTCG
GTTCGCATCATGTCATCCGGCTTCTCTTCTTGTCCGTGCTGATGCCCCTCGTCATGGG
CAAAGATGCGCGCAAACGGGACGGCGACACCTGAcgaacactggccatccgtgccgacaggagccatcgacgcaa
aaatgcggatggcgtgcaacctttttttcttccggccgttgatacttcgccgcaattgcggcggcgatttttcgcctgttcggcaggctgacccaccgga
ggactattcATG

    Atu0199 Gene: Atu0199     GI: 17934116     BI number: Atu0199     GOG: COG1732     Description: ABC transporter, substrate binding protein [proline/glycine/betaine             c aa       t  t a  a      t  t at       t  c cg       t  c gc       t  g cg       t  g a  |      t  c g  |      c  c cg        cg ta        at at        at cg        cg cg       |  a        t gc       |  t      t  g |  g      |  a      a  c |  t      |  c      a  g |  g      g  t       cg |  c      t  t       gc |  a       gc        cg a  a       cg        cg gc        gc        gc gc        gc        cg at        tg        ta                         tttttcgcctgttcggcaggctgacccaccggaggactattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1732 Periplasmic glycine betaine/choline-binding (lipo)protein of an ABC-type transport system (osmoprotectant binding protein) ... can be seen here     ..................................................................................................................