                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:150 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACCATCCGCCACAAGCCGGTCATAAGCCTCGACAATGGTGGACGTGGAAAGCTGCAT
GGTCTTTGCCAGCGCCCGCACGGATGGCAGGCGAGCACCCGGAACAAGGCTGCGCGAG
GTGATGCGCTGGCGGATATTCGCCATCACCTTTTCTATACGTGTGCCTGCCATGACCT
TCCCGTCCACatccatccctaaccgtactgcttttaagaccataacagtttattgatattgtatcgtattgtcgctgttcctgccagccattc
cggatcaagaaaggcaaaaggcaggagacgatcATG

    Atu0234 Gene: Atu0234     GI: 17934150     BI number: Atu0234     GOG: COG0697     Description: conserved hypothetical protein, membrane protei GG A  C AT CG        TA A  C      A  T A  G       GT G  |       GC GC        CG CG        GC |  A       GC CG        TA CG       C  | AT       G  | CG       C  | |  A      G  | G  T      T  | A  G       AT GC        GC CG        TA GC        GC GT        GC             TTTTCTATACGTGTGCCTGCCATGACCTTCCCGTCCACatccatccctaaccgtactgcttttaagaccataacagtttattgatattgtatcgtattgtcgctgttcctgccagccattccggatcaagaaaggcaaaaggcaggagacgatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................