                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-24.30 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCTGAACAAGGCTGGCATCGAAGTCGACCGCAAGGTTCTGTCCGACATGGCTATC
CATGAGCCGGCAGCATTCGGCGCGCTCGTTGAAGCCGCGAAGAAGGCGCTTGAGTACC
TCAAGGATGCCGGTACGACCAACGAGTTTGAAACCGCTGTAAAGTAAttacggcgcggacaatct
gttgtcattttaaacccgcgtcgggaaaccggcgcgggtttttcgttttgagctgctgatacatttccatcggtgttttttaatttagaaatttagaaga
gttggagtattcacgccgtTTG

    Atu0257 --- pheS --- pheT Gene: Atu0257     GI: 17934173     BI number: Atu0257     GOG: NOG09259     Description: conserved hypothetical protein Gene: pheS     GI: 17934174     BI number: Atu0258     GOG: COG0016     Description: phenylalanyl-tRNA synthetase, alpha-subunit Gene: pheT     GI: 17934175     BI number: Atu0259     GOG: COG0072,COG0073     Description: phenylalanyl-tRNA synthetase beta chai            ct           t  g            at            at   T        cg G  A       at A  A      |  c At       |  a At       |  t Ta       |  t Gc       |  t Tg       |  t Cg       |  a       aa Gc       |  a      g  a Cg       |  a       gc C  |      |  c       gc A  |       gc        cg A  |       gc        tg A  |       cg        gc Gc        gc        cg Tg        cg        gc Tg        gt        cg Ta        gc        cg Gc        cg        cg                         tttttcgttttgagctgctgatacatttccatcggtgttttttaatttagaaatttagaagagttggagtattcacgccgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0016 Phenylalanyl-tRNA synthetase alpha subunit ... can be seen here [J] COG0072 Phenylalanyl-tRNA synthetase beta subunit ... can be seen here [R] COG0073 EMAP domain ... can be seen here     ..................................................................................................................