                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:212 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTATTGTAAGGCCCATAAACCTCTGCCGTATCAAAAAAGGTGACACCAAGTTCCAC
GGCGCGGTGCAGCGTCGCTATTGCGCTGTTTTCATCGCCGGTCGGGCTATAGGCATGG
GTCATTCCCATGCAGCCCAGGCCAAGCGCCGAAACGGAAAGGTTGTTTCCGAGGGTTC
TTTTTTTCATctgttcgtccttccataaggaaccgcccgtcatcagggcgtgatcagaaaatagcgtctcatggcggtaaaaataatcgctgc
aaatccgcttgggttgttctatcatttagaacaATG

    Atu0261 Gene: Atu0261     GI: 17934177     BI number: Atu0261     GOG: COG0583     Description: transcriptional regulator, LysR famil             C           C  A           A  A            CG            AT            GT           T  |            GC   a        GC c  t      A  | t  t      A  | at       A  | ta       A  | cg       A  | ta       A  |       CG ta       C  |      G  T gc       T  |      A  C ta       A  |       CG tA        TA        GC gT        GC       |  T |  G       CG        TA gC        CG        GT gT        GC        GT t  C       TG        CG t  T      C  C       GC cG        TG        CG gC        CG        GC                         TGTTTTCATCGCCGGTCGGGCTATAGGCATGGGTCATTCCCATGCAGCCCAGGCCAAGCGCCGAAACGGAAAGGTTGTTTCCGAGGGTTCTTTTTTTCATctgttcgtccttccataaggaaccgcccgtcatcagggcgtgatcagaaaatagcgtctcatggcggtaaaaataatcgctgcaaatccgcttgggttgttctatcatttagaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................