                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.24 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -9.61 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGGCGAAGATGCGATTTTTCTGCTGGCGGATGCGGGTTCGCCAACACTGGTTCGCGA
TACCGCCGGCGACGACGCACTCTATGTTCTGATGCCGATGCGCGTTTAAaaccgaccgttttct
tcaatttttccagaaacgccggtggatcgcttcatcggcgttttttgattcggcgaacaggtggctctacccgtaactgaattttctcagttacgacatt
ttgccttgtttttgcgccaaatgggatcaacagtacgtaacaattttttgacaatgaccaatacatccgaggggaatcATG

    Atu0300 Gene: Atu0300     GI: 17934216     BI number: Atu0300     GOG: COG3963     Description: methyltransferas TG C  A T  T TG GC T  C A  | T  | CG TA C  | AT CG GC        tt CG       a  t A  |      a  t GC       c  t CG       t  c AT       t  c |  T      c  a       cg |  T       tg       t  c |  A       ta        at |  A       ta        gt |  a       ta        gc |  a       gc        ta |  c       cg        gt Gc       c  c       gc Cg       a  |       cg |  a       gc        cg Gc        cg        gc Gc        cg        cg Cg        at        at                         tttttgattcggcgaacaggtggctctacccgtaactgaattttctcagttacgacattttgccttgtttttgcgccaaatgggatcaacagtacgtaacaattttttgacaatgaccaatacatccgaggggaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG3963 Phospholipid N-methyltransferase ... can be seen here     ..................................................................................................................